Holiday schedule

For the upcoming holiday weeks, Genome Sciences Facility will be staffed on 12/22, 12/23, 12/24 and 12/29, 12/30, 12/31.
There will be no staff available Thursdays or Fridays either week.
Regular hours will resume the week of January 5.

Genewiz Sanger sequencing service will not be available for pick up on 12/25 and 1/1. Anything shipped on the 26th or the 2nd will not be processed until MONDAY as they do not accept packages on Saturdays.
Some may choose to wait and ship their packages on Monday so they do not sit with FedEx over the weekend.

I myself will be in office except 12/24 morning, 12/25, and 1/1, so I’m happy to assist Genewiz shipping if anyone wishes to ship out on 26th or 2nd.

Thank you and I’m wishing you safe and happy holidays!

Yuka

Happy Thanksgiving!

GS core will be closed on Thursday, Nov. 27 and Friday, Nov. 28 . Genewiz will receive the samples submitted on Nov. 26 (Wed) on Nob. 28 (Fri) and return the data within the day.

We are working hard to get 2 HiSeq Rapid runs started this evening knowing there will be a first snow storm here tomorrow!

Please stay safe and warm…

Happy Thanksgiving!

-Yuka

Small RNA-seq analysis

This is just a memorandum of my analysis workflow… investigators are welcome to use below for your own analysis ! :)

(run in our High Performance Computation cluster)

module load fastx_toolkit

fastq_quality_filter -Q33 -q 20 -p 80 -i test.fastq | fastq_quality_trimmer -Q33 -t 20 -l 10 -o test_filtered.fastq #filtering poor quality reads

fastq_to_fasta -r -n -Q33 -i test_filtered.fastq -o test.fa #convert to multi-fasta format

fastx_clipper -a TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC -l 18 -i test.fa -o test_clipped.fa #clip adapter (BioO)

fastx_trimmer -t 4 -i test_clipped.fa -o test_clipped_trimmed.fa #clip 4 bases from 3’ end (BioO introduced random 4 bases in its both adapters)

fastx_trimmer -f 5 -i test_clipped_trimmed.fa -o test_clipped_trimmed2.fa #clip 4 bases from 5’ end (BioO introduced random 4 bases in its both adapters)

#load test_clipped_trimmed2.fa to mirAnalyzer

#read count from mirAnalyzer to be analyzed for differential expression by DESeq

Illumina user group meeting 100214 @NYC

Took a 5am train to go to Manhattan!
Mike Smith I know since I was at Yale gave a beautiful presentation on their Portfolio and below is what I made a note from his talk.

There were a couple of exciting scientific presentations as well!
Worth the trip! :)

-Yuka


Portfolio:
HiSeq
Patients
Elana Simons-15WGS and RNAseq to find her own disease gene -Science
Balor-VCrome-only 25% found causative mutations
FORGE-264 rare disorders
Ebola-Aug2014 paper 314 SNVs
Coffee genome

NextSeq500
1/3 price of HiSeq
first paper-ribosome profiling in S.pombe
NIPT-fetal cell fee DNA (cfDNA) in maternal blood
Oncology-cfDNA non-invasive biomarkers, circulating DNA, circulating tumor cells, exosomes, immune cells

MiSeq
1X36bp-2X300bp
government agencies are using public health genomic epidemiology, food borne pathogen outbreaks, genomic epidemiology…FDA,CDC,etc
Host lifestyle affects human microbiota on daily timescales-sampled their oral and gut micro biome daily for one year, wrote an iOS app to chronicle daily activities
metatranscriptomics of human oral micro biome during health and disease compared OTUs of oral microbiota of health and periodontal disease samples, OTUs present varied across samples
pathogen detection using MiSeq-NEJMpaper-lepto infection found to be causative and treated with penicillin G

TruSight sequencing panels
One,inherited diseases, autism cancer cardiomyopathy tumor myeloid

MiSeq Dx, FDA cleared NGS system

pre-implantation genetic screening
VeriSeq PGS-chromosome anneuploidiity screen
HLA typing coming in 2014!
Forensics-new kit coming, new forensic MiSeq coming too

Informatics
BaseSpace-Over 30 Apps available
VariantStudio-variants-filter-interpret-report-biological insight (available in BaseSpace)

Arrays
MEGA consortium, multi-ethnic GWAS exome array
PsychArray
ImmunoChip v2
Ag Consortia

Illumina grant opportunities

You can apply on your own, and win your own reagent!

http://www.illumina.com/landing/miseqfocusoffer/?mkt_tok=3RkMMJWWfF9wsRovvKnIZKXonjHpfsX%2F6OkoXLHr08Yy0EZ5VunJEUWy34oDStQ%2FcOedCQkZHblFnVoISq2tWbgNo6cK#.VCmL19xs-yc

http://www.illumina.com/landing/lovemyhiseqoffer/?mkt_tok=3RkMMJWWfF9wsRovvKnIZKXonjHpfsX%2F6OkoXLHr08Yy0EZ5VunJEUWy34oDStQ%2FcOedCQkZHblFnVoISq2tWbgNo6cK#.VCmNENxs-yc

Good luck!

-Yuka