Updates on our services/costs

Happy 2015!

Finally I’m updating my blog as well as the GS core web site with lots of new information on our currently available services and prices. Glad I finally came here! We keep growing and we will be able to accommodate any genomics services you might have in your mind. Just give me a shout with your ideas!

Cheers,

Yuka

Genome Sciences Core Facility

Summary Statement: (last updated 1/16/15)

The Penn State Hershey Genome Sciences Facility is a full service facility and provides consultation, instrumentation, and services to both Penn State and non-Penn State investigators in genomic, epigenomic, and transcriptomic studies (http://www.pennstatehershey.org/web/core/gene-expression-analysis-overview). The variety of instrumentation allows for capabilities ranging from highly focused analysis of candidate SNPs, and mRNAs to whole genome, exome, epigenome, and transcriptome sequencing. Services are also available for a variety of study designs extending from a few laboratory samples to large (100s to 1,000s of samples) clinical projects. The full bioinformatics service is also available for data analysis.

The Facility resides in 5,000 sq ft of newly renovated space, encompassing separate “pre-amplification” and “post-amplification” rooms to prevent any contamination of PCR-amplified materials to pre-processed input DNA/RNA samples. Four well-experienced staffs are available for assisting project operation. In addition, the lab space is available for investigators who need temporary room for sample preparation.

We receive either tissue, DNA/RNA, or customer-generated NGS libraries. We process samples according to the prior consultation and agreement on the design of experiment. We develop new applications to accommodate state-of-the-art NGS technologies. We conduct sequencing reads alignment, secondary analysis (quantitation, variant calling, functional annotation, visualization, etc) and follow-up the interpretation of the results. We support grant writings and educate/train students/post-docs for hands-on NGS processing.

For the most up-to-date information, see the facility’s web page and links at http://med.psu.edu/web/core/gene-expression-analysis.

 

Facility Details: (last updated 1/16/15)

Nucleic acid processing and analysis: The Facility maintains equipment for nucleic acid extraction (QIAsymphony and Bullet Blender), sonication (Covaris adaptive focused acoustics ultrasonicator E-series), quantitation and quality control (Agilent 2100 Bioanalyzer, Nanodrop Spectrophotometer, Qubit, and access to a Molecular Devices FlexStation 3 UV/Vis/Fluor spectrophotometer). An LifeTech QuantStudio 12K Flex system with robotic plate handler and QuantStudio 3D digital PCR system is available for qPCR gene expression and genotyping services. The Facility provides custom Sanger sequencing of plasmid, PCR and BAC templates. We can also run fragment analysis assays including footprinting, microsatellite, loss of heterozygosity (LOH), SSCP, RFLP and genotyping/SNPlex (multiplexed SNP analysis). Cost for each service is as follows (we allow walk-up and free usage of Nanodrop and Qubit, please inquire for the usage of FlexStation 3) :

Sample prep and PCR service for base cost -1 sample cost per additional sample
RNA isolation $14.5
DNA isolation $8.7
Covaris $8.00
Bioanalyzer (DNA, RNA, protein) (up to 11-12 samples) $60
cDNA synthesis $1.87
Usage of QuantStudio 12K Flex $14.00
Kapa library qPCR $33.19 $1.52
Digital qPCR $10.50
GoTaq PCR $2.16
QIAsymphony service cost per sample
Whole Blood DNA prep 200 $5.90
Whole Blood DNA prep 400 $7.40
Whole Blood DNA prep 1000 $10.80
DNA prep buffy coat 200 $5.90
DNA prep buffy coat 400 $7.40
RNA prep 400 $6.40
RNA prep 800 $12.00
PAXgene_RNA $12.00
Saliva DNA prep 1000 $10.80

 

Sanger sequencing cost per sample
Custom Sequencing $6.50
BAC samples $9.50
Fragment analysis $2.00

 

Microarray: The Facility offers Illumina platforms as the main microarray-based procedure for genotyping and gene expression. The recently acquired iScan system allows high-throughput and cost-effective microarray analysis of genotyping, gene expression, copy number analysis, methylation analysis and LOH studies. Roche and Agilent microarray equipment is also available. Individual SNP calls can be confirmed by PCR tools described above. Listed below are the costs of some popular microarrays.

Microarray service minimum sample number required cost per sample
Infinium Omni 2.5 (16 samples) 16 214.13
Infinium Omni 2.5 (48 samples) 48 200.63
Human Omni 5 16 319.17
Human Omni Express-24 v1.0 48 149.65
Infinium Methylation 48 334.99
Human gene expression 24 98.72
Mouse gene expression 24 132.65

 

Next Generation Sequencing platforms: For next generation sequencing projects the Facility offers a range of workflows depending on investigator needs and number of reads/length of sequence required for the project. The Facility contains a MiSeq system to perform low output applications (from 300 Mb to 7.5 Gb in ~4 to 39 hours) and a HiSeq 2500 system, which allows data collection in both rapid run (up to 90 Gb/flow cell, 2×150 bp, in 40 hours) and high output modes (up to 300 Gb/flow cell, 2×100 bp, in ~11 days) on either one or two flow cells. The Facility also maintains a LifeTech Ion Proton DNA sequencer for targeted sequencing and exome sequencing (10 Gb with sequencing run time of 2-4 hours). An Apollo 324 robotic system supports a variety of automated library preparation protocols for whole genome, whole exome, ChIP-seq, RNA-seq and targeted resequencing. Listed below are currently operated services, but we are expanding the service to meet the needs of each investigator.

NGS library prep service cost per sample*
whole genome sequencing WGS library prep (minimum input DNA 100 ng) $50.12
whole exome sequencing exome (Human) (minimum input DNA 1 ng for intact DNA, under R&D for FFPE DNA) $362.18
exome (other species, mouse, bovine, zebrafish) please inquire
ChIP sequencing ChIP-seq library prep (minimum input DNA 0.5 ng) $50.12
Low input ChIP-seq library prep (minimum input DNA 0.05 ng) $115.33
Methylation sequencing ERRBS (enhanced reduced representation of bisulfite sequencing) library prep $99.33
RNA sequencing PolyA RNA seq library prep (strand-specific, minimum input RNA 50 ng) $69.01
Total RNA seq library prep (rRNA depleted, human, mouse, rat, standard rRNA-depletion, strand-specific, minimum input RNA 100 ng) $160.55
Low Input RNA-seq library prep (minimum input RNA 10 pg, or single cell) $80.88
Low Input cDNA synthesis (minimum input RNA 10 pg, or single cell) $70.35
Degraded Low Input RNA-seq library prep (minimum input RNA 10 ng) $194.58
Degraded Low Input cDNA synthesis $144.46
Small RNA seq library prep (minimum input RNA 1 ug) $96.96
Low input small RNA-seq library prep (minimum input RNA 100 ng) $114.97
Single cel RNA-seq (up to 96 samples) please inquire
*QC bioanalyzer run will be added (usually 3 runs ($180) up to 11 samples)

 

Seq only 2X: paired end, 1X: single end
HiSeq 2500
Rapid per 2 lanes (need 2 lanes to run the flow cell) Reagent kit No. of reads (million) per flow cell (2 lanes run mixed/run together) cost 
2X100 300 $3,823.32
2X50 300 $3,714.45
1X100 300 $2,406.68
1X50 300 $1,756.73
Rapid per lane (need 2 lanes to run the flow cell, cBot duo to separate lane 1 and 2) Reagent kit No. of reads per lane cost 
2X100 150 $2,129.66
2X50 150 $2,075.23
1X100 150 $1,421.34
1X50 150 $1,096.37
Output per lane (need 8 lanes to run the flow cell) Reagent kit No. of reads per lane cost
2X100 175 $2,145.10
2X50 175 $1,612.11
1X100 175 $1,284.72
1X50 175 $876.62
MiSeq
versions MiSeq reagent kit No. of reads (million) cost
v2 series 2X250 15 $1,271.10
2X150 15 $1,164.39
2X50 15 $955.93
2X150 micro (small genome) 4 $1,006.31
2X150 nano (small genome, QC) 1 $746.39
v3 series 2X75 25 $1,209.63
2X300 25 $1,820.22

 

Bioinformatics Support: The Penn State College of Medicine has three dedicated High Performance Computing (HPC) systems with a total of 136 CPU Cores, 768GB RAM and 50TB of local storage in addition to the 80 TB Storage Area Network (SAN). For the non-human subject samples, we also have access to the world class High Performance Compute systems at Penn State University Park, including BioSTAR (512 processor cores, 4 TB of aggregate memory, and 624 TB of disk storage) and CyberSTAR (1,920 cores and 7.68 TB memory, and 650 TB storage). We conduct sequencing reads alignment, secondary analysis (quantitation, variant calling, functional annotation, visualization, etc), as well as statistical analysis correlating genomic with phenotypic information. There is no charge for the consultation and we encourage each investigator to make an appointment with Director/staffs in advance to secure enough time for discussion. Director’s availability is found in the 4th tab of below web site(http://sites.psu.edu/yuka/). Bioinfomatics service will be charged at $60 per hands on hour. Each project is different, so investigators are encouraged to contact us to estimate the necessary hours for each project.

Bioinformatics support cost per hour
Bioinformatics support $60.00

 

 

Holiday schedule

For the upcoming holiday weeks, Genome Sciences Facility will be staffed on 12/22, 12/23, 12/24 and 12/29, 12/30, 12/31.
There will be no staff available Thursdays or Fridays either week.
Regular hours will resume the week of January 5.

Genewiz Sanger sequencing service will not be available for pick up on 12/25 and 1/1. Anything shipped on the 26th or the 2nd will not be processed until MONDAY as they do not accept packages on Saturdays.
Some may choose to wait and ship their packages on Monday so they do not sit with FedEx over the weekend.

I myself will be in office except 12/24 morning, 12/25, and 1/1, so I’m happy to assist Genewiz shipping if anyone wishes to ship out on 26th or 2nd.

Thank you and I’m wishing you safe and happy holidays!

Yuka

Happy Thanksgiving!

GS core will be closed on Thursday, Nov. 27 and Friday, Nov. 28 . Genewiz will receive the samples submitted on Nov. 26 (Wed) on Nob. 28 (Fri) and return the data within the day.

We are working hard to get 2 HiSeq Rapid runs started this evening knowing there will be a first snow storm here tomorrow!

Please stay safe and warm…

Happy Thanksgiving!

-Yuka

Small RNA-seq analysis

This is just a memorandum of my analysis workflow… investigators are welcome to use below for your own analysis ! :)

(run in our High Performance Computation cluster)

module load fastx_toolkit

fastq_quality_filter -Q33 -q 20 -p 80 -i test.fastq | fastq_quality_trimmer -Q33 -t 20 -l 10 -o test_filtered.fastq #filtering poor quality reads

fastq_to_fasta -r -n -Q33 -i test_filtered.fastq -o test.fa #convert to multi-fasta format

fastx_clipper -a TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC -l 18 -i test.fa -o test_clipped.fa #clip adapter (BioO)

fastx_trimmer -t 4 -i test_clipped.fa -o test_clipped_trimmed.fa #clip 4 bases from 3’ end (BioO introduced random 4 bases in its both adapters)

fastx_trimmer -f 5 -i test_clipped_trimmed.fa -o test_clipped_trimmed2.fa #clip 4 bases from 5’ end (BioO introduced random 4 bases in its both adapters)

#load test_clipped_trimmed2.fa to mirAnalyzer

#read count from mirAnalyzer to be analyzed for differential expression by DESeq

Illumina user group meeting 100214 @NYC

Took a 5am train to go to Manhattan!
Mike Smith I know since I was at Yale gave a beautiful presentation on their Portfolio and below is what I made a note from his talk.

There were a couple of exciting scientific presentations as well!
Worth the trip! :)

-Yuka


Portfolio:
HiSeq
Patients
Elana Simons-15WGS and RNAseq to find her own disease gene -Science
Balor-VCrome-only 25% found causative mutations
FORGE-264 rare disorders
Ebola-Aug2014 paper 314 SNVs
Coffee genome

NextSeq500
1/3 price of HiSeq
first paper-ribosome profiling in S.pombe
NIPT-fetal cell fee DNA (cfDNA) in maternal blood
Oncology-cfDNA non-invasive biomarkers, circulating DNA, circulating tumor cells, exosomes, immune cells

MiSeq
1X36bp-2X300bp
government agencies are using public health genomic epidemiology, food borne pathogen outbreaks, genomic epidemiology…FDA,CDC,etc
Host lifestyle affects human microbiota on daily timescales-sampled their oral and gut micro biome daily for one year, wrote an iOS app to chronicle daily activities
metatranscriptomics of human oral micro biome during health and disease compared OTUs of oral microbiota of health and periodontal disease samples, OTUs present varied across samples
pathogen detection using MiSeq-NEJMpaper-lepto infection found to be causative and treated with penicillin G

TruSight sequencing panels
One,inherited diseases, autism cancer cardiomyopathy tumor myeloid

MiSeq Dx, FDA cleared NGS system

pre-implantation genetic screening
VeriSeq PGS-chromosome anneuploidiity screen
HLA typing coming in 2014!
Forensics-new kit coming, new forensic MiSeq coming too

Informatics
BaseSpace-Over 30 Apps available
VariantStudio-variants-filter-interpret-report-biological insight (available in BaseSpace)

Arrays
MEGA consortium, multi-ethnic GWAS exome array
PsychArray
ImmunoChip v2
Ag Consortia