One day I got a question from my customer, something like this:
—————————————————————-
For the adapter sequences, you gave me the following info:
AdapterRead1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
AdapterRead2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Are these from the 5’ or 3’ end? To which end of the sequence do you
attach the adapters? What is the difference between Read1 and Read2?
Do they go on different ends of the sequence?
—————————————————————-
And here is my reply:
—————————————————————-
I hope below will help!
http://bitesizebio.com/13542/what-everyone-should-know-about-rna-seq/
(the cartoon in the middle)
http://seqanswers.com/forums/archive/index.php/t-17521.html
(example cutadapt trimming scripts)
In case of paired end sequencing, trim Read1 adapter from Read1 fastq, and Read2 adapter from Read2 fastq.
In our default CASAVA blc2fastq workflow (except small RNA-seq data), we mask the adapter sequences, so in case you have adapter sequence in its 3′ end of the sequencing reads (this happens if your insert was shorter than your sequencing length), you will see ‘NNNNN’ instead of the adapter sequences. We can leave the adapter sequences as they are and let you to trim them using e.g. above method, so just let us know if that’s your preference.
Thank you!
Yuka